genbank-parser
This work was based on TeselaGen/ve-sequence-parsers.
Parse genbank files.
Usage
const fs = require('fs');
const genbankParser = require('genbank-parser');
const genbank = fs.readFileSync('./genbank.gb', 'utf-8');
const result = genbankParser(genbank);
Parsed fields
The parser tries to parse all fields described by the genbank documentation Additional properties are added: At the sequence level:
-
name
: locus name
At the feature level
-
name
: extracted from several possible feature notes. Default is/label
Example
Input genbank
LOCUS Z78533 740 bp DNA linear PLN 30-NOV-2006
DEFINITION C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA.
ACCESSION Z78533
VERSION Z78533.1 GI:2765658
KEYWORDS 5.8S ribosomal RNA; 5.8S rRNA gene; internal transcribed spacer;
ITS1; ITS2.
SOURCE Cypripedium irapeanum
ORGANISM Cypripedium irapeanum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Asparagales; Orchidaceae;
Cypripedioideae; Cypripedium.
REFERENCE 1
AUTHORS Cox,A.V., Pridgeon,A.M., Albert,V.A. and Chase,M.W.
TITLE Phylogenetics of the slipper orchids (Cypripedioideae:
Orchidaceae): nuclear rDNA ITS sequences
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 740)
AUTHORS Cox,A.V.
TITLE Direct Submission
JOURNAL Submitted (19-AUG-1996) Cox A.V., Royal Botanic Gardens, Kew,
Richmond, Surrey TW9 3AB, UK
FEATURES Location/Qualifiers
source 1..740
/organism="Cypripedium irapeanum"
/mol_type="genomic DNA"
/db_xref="taxon:49711"
misc_feature 1..380
/note="internal transcribed spacer 1"
gene 381..550
/gene="5.8S rRNA"
rRNA 381..550
/gene="5.8S rRNA"
/product="5.8S ribosomal RNA"
misc_feature 551..740
/note="internal transcribed spacer 2"
ORIGIN
1 cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat tgatgagacc gtggaataaa
61 cgatcgagtg aatccggagg accggtgtac tcagctcacc gggggcattg ctcccgtggt
121 gaccctgatt tgttgttggg ccgcctcggg agcgtccatg gcgggtttga acctctagcc
181 cggcgcagtt tgggcgccaa gccatatgaa agcatcaccg gcgaatggca ttgtcttccc
241 caaaacccgg agcggcggcg tgctgtcgcg tgcccaatga attttgatga ctctcgcaaa
301 cgggaatctt ggctctttgc atcggatgga aggacgcagc gaaatgcgat aagtggtgtg
361 aattgcaaga tcccgtgaac catcgagtct tttgaacgca agttgcgccc gaggccatca
421 ggctaagggc acgcctgctt gggcgtcgcg cttcgtctct ctcctgccaa tgcttgcccg
481 gcatacagcc aggccggcgt ggtgcggatg tgaaagattg gccccttgtg cctaggtgcg
541 gcgggtccaa gagctggtgt tttgatggcc cggaacccgg caagaggtgg acggatgctg
601 gcagcagctg ccgtgcgaat cccccatgtt gtcgtgcttg tcggacaggc aggagaaccc
661 ttccgaaccc caatggaggg cggttgaccg ccattcggat gtgaccccag gtcaggcggg
721 ggcacccgct gagtttacgc
//
Parsed output
[
{
features: [
{
locations: [],
notes: {
organism: ['Cypripedium irapeanum'],
mol_type: ['genomic DNA'],
db_xref: ['taxon:49711']
},
type: 'source',
strand: 1,
start: 1,
end: 740,
name: 'Cypripedium irapeanum'
},
{
locations: [],
notes: { note: ['internal transcribed spacer 1'] },
type: 'misc_feature',
strand: 1,
start: 1,
end: 380,
name: 'internal transcribed spacer 1'
},
{
locations: [],
notes: { gene: ['5.8S rRNA'] },
type: 'gene',
strand: 1,
start: 381,
end: 550,
name: '5.8S rRNA'
},
{
locations: [],
notes: { gene: ['5.8S rRNA'], product: ['5.8S ribosomal RNA'] },
type: 'rRNA',
strand: 1,
start: 381,
end: 550,
name: '5.8S rRNA'
},
{
locations: [],
notes: { note: ['internal transcribed spacer 2'] },
type: 'misc_feature',
strand: 1,
start: 551,
end: 740,
name: 'internal transcribed spacer 2'
}
],
name: 'Z78533',
sequence:
'cgtaacaaggtttccgtaggtgaacctgcggaaggatcattgatgagaccgtggaataaacgatcgagtgaatccggaggaccggtgtactcagctcaccgggggcattgctcccgtggtgaccctgatttgttgttgggccgcctcgggagcgtccatggcgggtttgaacctctagcccggcgcagtttgggcgccaagccatatgaaagcatcaccggcgaatggcattgtcttccccaaaacccggagcggcggcgtgctgtcgcgtgcccaatgaattttgatgactctcgcaaacgggaatcttggctctttgcatcggatggaaggacgcagcgaaatgcgataagtggtgtgaattgcaagatcccgtgaaccatcgagtcttttgaacgcaagttgcgcccgaggccatcaggctaagggcacgcctgcttgggcgtcgcgcttcgtctctctcctgccaatgcttgcccggcatacagccaggccggcgtggtgcggatgtgaaagattggccccttgtgcctaggtgcggcgggtccaagagctggtgttttgatggcccggaacccggcaagaggtggacggatgctggcagcagctgccgtgcgaatcccccatgttgtcgtgcttgtcggacaggcaggagaacccttccgaaccccaatggagggcggttgaccgccattcggatgtgaccccaggtcaggcgggggcacccgctgagtttacgc',
circular: false,
moleculeType: 'DNA',
genbankDivision: 'PLN',
date: '2006-11-30T12:00:00.000Z',
size: 740,
definition: 'C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA.',
accession: 'Z78533',
version: 'Z78533.1 GI:2765658',
keywords:
'5.8S ribosomal RNA; 5.8S rRNA gene; internal transcribed spacer; ITS1; ITS2.',
source: 'Cypripedium irapeanum',
organism:
'Cypripedium irapeanum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; Liliopsida; Asparagales; Orchidaceae; Cypripedioideae; Cypripedium.',
references: [
{
description: '1',
authors: 'Cox,A.V., Pridgeon,A.M., Albert,V.A. and Chase,M.W.',
title:
'Phylogenetics of the slipper orchids (Cypripedioideae: Orchidaceae): nuclear rDNA ITS sequences',
journal: 'Unpublished'
},
{
description: '2 (bases 1 to 740)',
authors: 'Cox,A.V.',
title: 'Direct Submission',
journal:
'Submitted (19-AUG-1996) Cox A.V., Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK'
}
]
}
];