prymer

Generate primers for input DNA sequences in an automated manner.

Installation

$ pip install prymer

Primer's only (running) dependency is biopython.

Usage

The only required arguments are positionals for the input sequence (in fasta or genbank format), and a file to write the output sequences to.

$ prymer.py sequences outfile

Full usage options

usage: prymer.py [-h] [-v] [-m {bracketed,sanger}] [-t TILE] [-o OFFSET]
                 [-l, LENGTH] [-f FORMAT]
                 [-s {25nm,100nm,250nm,1um,5um,10um,4nmU,20nmU,PU,25nmS}]
                 [-p {STD,PAGE,HPLC,IEHPLC,RNASE,DUALHPLC,PAGEHPLC}]
                 sequences outfile

Return primers for given input sequences.

positional arguments:
  sequences             The sequence file to design primers for. It is assumed
                        all sequences are provided 5' -> 3'
  outfile               Output file of primers in the chosen format.

optional arguments:
  -h, --help            show this help message and exit
  -v, --verbose         Print additional information about the designed
                        sequences (to STDERR).

Primer Customisation Options:
  -m {bracketed,sanger}, --method {bracketed,sanger}
                        The design scheme for the primers (i.e. how to design
                        them).Current options: bracketed - Designs 'normal' 5'
                        and 3' amplification primers. sanger - Designs 'primer
                        walking' primers, approximately 800bp apart
  -t TILE, --tile TILE  Use this option to overwrite the default between-
                        primer walking distance to increase the sequencing
                        overlap (e.g. for poor sequencing results. Sanger
                        sequencing typically returns about ~1kb of usable
                        sequence, but the 3' end will often begin to become
                        error-laden.
  -o OFFSET, --offset OFFSET
                        A small offset from the start of the sequence, to
                        manipulate primer position. This helps increase 5'
                        junction primer coverage.
  -l, LENGTH, --length LENGTH
                        Desired length of primer sequences.

Output Options:
  -f FORMAT, --format FORMAT
                        What file type to output the primers as (fasta,
                        separated by delimiter of choice, or IDT bulk upload
                        format).Delimiter should be specified in quotes, e.g.
                        ',' or ';'.
  -s {25nm,100nm,250nm,1um,5um,10um,4nmU,20nmU,PU,25nmS}, --synthesis {25nm,100nm,250nm,1um,5um,10um,4nmU,20nmU,PU,25nmS}
                        Specify synthesis scale options to add to IDT output
                        (e.g. "25nm")
  -p {STD,PAGE,HPLC,IEHPLC,RNASE,DUALHPLC,PAGEHPLC}, --purification {STD,PAGE,HPLC,IEHPLC,RNASE,DUALHPLC,PAGEHPLC}
                        Purification type for IDT output.

Easy peasy primer design. Recent updates now include the ability to return
melting temperatures, as well as design overlapping/primer-walking schemes.

Currently, there are 2 main 'modes' of primer design: Bracketed and Sanger.

Bracketed primers are 'normal' amplification primers, matching the start and end of a given sequence.

e.g, for the sequence below, bracket primers appear as:

F-TGGGTAAAATAATTGGTATC->
  ATGGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAGCGATTATGGATGGCACCACTCCTCGCGTGCTGGAGAACGCCGAA
                                                                         <-AAGCCGCAAGAGGTCGTGCG-R

The reverse primer is of course reverse complemented relative to the forward sequence.

Sanger primers provide 'tiled' primers for primer walking across a sequence (mainly intended for sequencing applications):

e.g., for the sequence below, 10-mer primers, tiled every 30 bp would appear as (showing forward only):

ATGGGTAAAA->                  ACTACCAACT->                  GGCACCACTC->
ATGGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAGCGATTATGGATGGCACCACTCCTCGCGTGCTGGAGAACGCCGAA

Options

• -t | --tile - the separation distance between Sanger sequencing primers
• -o | --offset - A 5' offset to 'nudge' all sequencing primers along the sequence (helps to span junctions etc.)
• -l | --length - A target length of primer to return. In future, iterative primer pair refinement will have some control over this, but for now primers are a static length.
• -f | --format - The output formats for the primers. By default the sequences will be written as fasta, but tabular formats with any custom separator can be specified. If "IDT" is specified, the primers will be output in a format for use with IDT, but you will also need to provide -p and -s (see below).
• -s | --synthesis - A string corresponding to one of IDT's synthesis scales. This string will be appended to the output if "IDT" was chosen*.
• -p | --purification - A string corresponding to one of IDT's purification methods*.

*Note, some purification methods and synthesis scales are mutually exclusive, but this script DOES NOT CHECK. Consult IDT's site.