>>> from seqrecord_expanded import SeqRecordExpanded
>>> seq_record = SeqRecordExpanded('TCTGAATGGAAGACAAAGCGTCCA',
...                                voucher_code='CP100-09',
...                                taxonomy={'genus': 'Melitaea',
...                                          'species': 'phoebe',
...                                         },
...                                gene_code='EF1a',
...                                reading_frame=1,
...                                table=1,  # translation table
...                                )
>>> # Degenerate sequence standard genetic code
>>> seq_record.degenerate()
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence S method
>>> seq_record.degenerate(method='S')
'AGYGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence Z method
>>> seq_record.degenerate(method='Z')
'TCNGARTGGAARACNAARMGNCCN'
>>>
>>> # Degenerate sequence SZ method
>>> seq_record.degenerate(method='SZ')
'NNNGARTGGAARACNAARMGNCCN'
>>>
>>> # get first codon positions
>>> seq_record.first_codon_position()
'TGTAAACC'
>>>
>>> # get second codon positions
>>> seq_record.second_codon_position()
'CAGACAGC'
>>>
>>> # get third codon positions
>>> seq_record.third_codon_position()
'TAGGAGTA'
>>>
>>> # get first and second positions
>>> seq_record.first_and_second_positions()
'TCGATGAAACAACGCC'
>>>
>>> # translate to aminoacid sequence
>>> seq_record.translate()
'SEWKTKRP'
>>> # translate to aminoacid sequence
>>> seq_record.translate(table=1)
'SEWKTKRP'