DDNA
Program / Library that converts sentences to DNA sequence and vice-versa.
O o O o O o
A O o | A O o | | O o G
| G O | C 1 | O G | T | O | 1
1 o O | T o O A | o O C
o O o O o OInstallation:
pip install ddnaUsage:
- program
python3 -m ddna -h
usage: ddna.py [-h] [-e ENCODE] [-d DECODE]
DDNA - DNA Encoder/Decoder
optional arguments:
-h, --help show this help message and exit
-e ENCODE, --encode ENCODE
Encode String to DNA
-d DECODE, --decode DECODE
Decode DNA to String
- pip package
>>> from ddna import DDNA
>>> DDNA().encode("HELLO WORLD")
'CAGACACCCATACATACATTAGAACCCTCATTCCAGCATACACA'
>>> DDNA().decode("CAGACACCCATACATACATTAGAACCCTCATTCCAGCATACACA")
'HELLO WORLD'
Plans:
- Introduce Mutations
- Introduce new form of encryption based on mutations
