python-linearfold

Unofficial CPython binding to LinearFold

Installation

Use pip to install the module.

pip install linearfold-unofficial

You may build from the source code for unsupported Python versions or platforms.

git clone --recursive https://github.com/ChangLabSNU/python-linearfold
cd python-linearfold
pip install .

Usage

The module currently only has one function called fold(seq), and it doesn't have any customizable options other than the defaults. The seq parameter should be an RNA sequence in uppercase letters, and any T should be converted to U before passing it to the function.

>>> import linearfold
>>> seq = 'UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA'
>>> linearfold.fold(seq)
('((((((((((((((((.(((((.(((((.(((.(((...))))))))))).)))))))))))))))))))))', -34.6)

The function returns a tuple with two elements. The first element is the predicted MFE structure, and the second element is the free energy of the structure in kcal/mol.

Author

Hyeshik Chang <hyeshik@snu.ac.kr>

License

This Python binding is licensed under the MIT-style license. However, the compiled binary includes code from the LinearFold package, which is licensed for non-commercial use.