Scans genome contigs against ResFinder, PlasmidFinder, and PointFinder databases


Keywords
antimicrobial-resistance, bioinformatics, genomics
License
Apache-2.0
Install
pip install staramr==0.7.0

Documentation

Build Status pypi conda

staramr

staramr (*AMR) scans bacterial genome contigs against the ResFinder, PointFinder, and PlasmidFinder databases (used by the ResFinder webservice and other webservices offered by the Center for Genomic Epidemiology) and compiles a summary report of detected antimicrobial resistance genes. The star|* in staramr indicates that it can handle all of the ResFinder, PointFinder, and PlasmidFinder databases.

Note: The predicted phenotypes/drug resistances are for microbiological resistance and not clinical resistance. This is provided with support from the NARMS/CIPARS Molecular Working Group and is continually being improved. A small comparison between phenotype/drug resistance predictions produced by staramr and those available from NCBI can be found in the tutorial. We welcome any feedback or suggestions.

For example:

staramr search -o out --pointfinder-organism salmonella *.fasta

out/summary.tsv:

Isolate ID Quality Module Genotype Predicted Phenotype CGE Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
SRR1952908 Passed aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline Spectinomycin, Streptomycin, Amoxicillin, Ampicillin, Cephalothin, Piperacillin, Ticarcillin, Chloramphenicol, Nalidixic acid, Ciprofloxacin, Sulfamethoxazole, Doxycycline, Tetracycline ColpVC, IncFIB(S), IncFII(S), IncI1-I(Alpha) senterica_achtman_2 11 4785500 250423 41
SRR1952926 Passed blaTEM-57, gyrA (S83Y), tet(A) ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline Amoxicillin, Ampicillin, Cephalothin, Piperacillin, Ticarcillin, Nalidixic acid, Ciprofloxacin, Doxycycline, Tetracycline ColpVC, IncFIB(S), IncFII(S), IncI1-I(Alpha) senterica_achtman_2 11 4785451 228311 40

out/detailed_summary.tsv:

Isolate ID Data Data Type Predicted Phenotype CGE Predicted Phenotype %Identity %Overlap HSP Length/Total Length Contig Start End Accession
SRR1952908 ST11 (senterica_achtman_2) MLST
SRR1952908 ColpVC Plasmid 98.96 100.0 193/193 contig00038 1618 1426 JX133088
SRR1952908 aadA1 Resistance streptomycin Spectinomycin, Streptomycin 100.0 100.0 792/792 contig00030 5355 4564 JQ414041

out/resfinder.tsv:

Isolate ID Gene Predicted Phenotype CGE Predicted Phenotype %Identity %Overlap HSP Length/Total Length Contig Start End Accession Sequence CGE Notes
SRR1952908 sul3 sulfisoxazole Sulfamethoxazole 100.00 100.00 792/792 contig00030 2091 2882 AJ459418 ATGA[...]
SRR1952908 tet(A) tetracycline Doxycycline, Tetracycline 99.92 97.80 1247/1275 contig00032 1476 2722 AF534183 ATGT[...]

out/pointfinder.tsv:

Isolate ID Gene Predicted Phenotype CGE Predicted Phenotype Type Position Mutation %Identity %Overlap HSP Length/Total Length Contig Start End Pointfinder Position CGE Notes CGE Required Mutation CGE Mechanism CGE PMID
SRR1952908 gyrA (S83Y) ciprofloxacin I/R, nalidixic acid Nalidixic acid,Ciprofloxacin codon 83 TCC -> TAC (S -> Y) 99.96 100.00 2637/2637 contig00008 22801 20165 S83Y Target modification 7492118,10471553
SRR1952926 gyrA (S83Y) ciprofloxacin I/R, nalidixic acid Nalidixic acid,Ciprofloxacin codon 83 TCC -> TAC (S -> Y) 99.96 100.00 2637/2637 contig00011 157768 160404 S83Y Target modification 7492118,10471553

out/plasmidfinder.tsv:

Isolate ID Plasmid %Identity %Overlap HSP Length/Total Length Contig Start End Accession
SRR1952908 ColpVC 98.96 100 193/193 contig00038 1618 1426 JX133088
SRR1952908 IncFIB(S) 98.91 100 643/643 contig00024 10302 9660 FN432031

out/mlst.tsv:

Isolate ID Scheme Sequence Type Locus 1 Locus 2 Locus 3 Locus 4 Locus 5 Locus 6 Locus 7
SRR1952908 senterica_achtman_2 11 aroC(5) dnaN(2) hemD(3) hisD(7) purE(6) sucA(6) thrA(11)
SRR1952926 senterica_achtman_2 11 aroC(5) dnaN(2) hemD(3) hisD(7) purE(6) sucA(6) thrA(11)

Table of Contents

Quick Usage

Search contigs

To search a list of contigs (in fasta format) for AMR genes using ResFinder please run:

staramr search -o out *.fasta

Output files will be located in the directory out/.

To include acquired point-mutation resistances using PointFinder, please run:

staramr search --pointfinder-organism salmonella -o out *.fasta

Where --pointfinder-organism is the specific organism you are interested in (currently only salmonella, campylobacter, enterococcus faecalis and enterococcus faecium are supported).

To specify which PlasmidFinder database to use, please run:

staramr search --plasmidfinder-database-type enterobacteriaceae -o out *.fasta

Where --plasmidfinder-database-type is the specific database type you are interested in (currently only gram_positive, enterobacteriaceae are supported). By default, both databases are used.

To specify which MLST scheme to use, please run:

staramr search -o out --mlst-scheme senterica *.fasta

Where --mlst-scheme is the specific organism you are interested in (please visit the scheme genus map to see which are available). By default, it detects the scheme automatically.

Database Info

To print information about the installed databases, please run:

staramr db info

Update Database

If you wish to update to the latest ResFinder, PointFinder, and PlasmidFinder databases, you may run:

staramr db update --update-default

If you wish to switch to specific git commits of either ResFinder, PointFinder, or PlasmidFinder databases you may also pass --resfinder-commit [COMMIT], --pointfinder-commit [COMMIT], and --plasmidfinder-commit [COMMIT].

Restore Database

If you have updated the ResFinder/PointFinder/PlasmidFinder databases and wish to restore to the default version, you may run:

staramr db restore-default

Installation

Bioconda

Separate conda environment

The easiest way to install staramr is through Bioconda (we recommend using mamba as an alternative to conda).

conda install mamba # Install mamba to make it easier to install later dependencies
mamba create -c conda-forge -c bioconda -c defaults --name staramr staramr

This will install the staramr software at the most recent version within the conda environment named staramr. Bioconda will install all necessary dependencies and databases. Once this is complete you can run:

conda activate staramr # Activate conda environment
staramr --help

Same conda environment

If, instead, you wish to install staramr to the current conda environment you can run:

mamba install -c conda-forge -c bioconda -c defaults staramr

You should now be able to run staramr --help and recieve a usage statement.

PyPI/Pip

You can also install staramr from PyPI using pip:

pip install staramr

However, you will have to install the external dependencies (listed below) separately.

Latest Code

If you wish to make use of the latest in-development version of staramr, you may update directly from GitHub using pip:

pip install git+https://github.com/phac-nml/staramr

This will only install the Python code, you will still have to install the dependencies listed below (or run the pip command from the previously installed Bioconda environment).

Alternatively, if you wish to do development with staramr you can use a Python virtual environment (you must still install the non-Python dependencies separately).

# Clone code
git clone https://github.com/phac-nml/staramr.git
cd staramr

# Setup virtual environment
virtualenv -p /path/to/python-bin .venv
source .venv/bin/activate

# Install staramr. Use '-e' to update the install on code changes.
pip install -e .

# Now run `staramr`
staramr

Due to the way we packaged the ResFinder/PointFinder/PlasmidFinder databases, the development code will not come with a default database. You must first build the database before usage. E.g.

staramr db restore-default

Dependencies

  • Python 3.7+
  • BLAST+
  • Git
  • MLST

Input

List of genes to exclude

By default, the ResFinder/PointFinder/PlasmidFinder genes listed in genes_to_exclude.tsv will be excluded from the final results. To pass a custom list of genes the option --exclude-genes-file can be used, where the file specified will contains a list of the sequence ids (one per line) from the ResFinder/PointFinder/PlasmidFinder databases. For example:

gene_id
aac(6')-Iaa_1_NC_003197
ColpVC_1__JX133088

Please make sure to include gene_id in the first line. The default exclusion list can also be disabled with --no-exclude-genes.

Complex Mutations

Complex mutations describe multiple point mutations that must be simultaneously present in order to confer resistance. One such example is the multiple pbp5 mutations that must be present in Enterococcus faecium in order to confer ampicillin resistance. These complex mutations may be specified by the user using a TSV-formatted file with the following format:

positions mandatory phenotype
gene (mutation1), gene (mutation2) gene (mutation1) phenotype

Where positions is all the point mutations to group into the complex mutation (optional and mandatory), mandatory is all the point mutations that must be present for the complex mutation to be reported (mandatory is a subset of positions), and phenotype is the phenotype that is conferred when this set of mutations is present. To see a specific example of this, please look at the default complex_mutations.tsv file included with StarAMR. The mutation will be reported in the pointfinder.tsv file similar to as follows:

Isolate ID Gene Predicted Phenotype CGE Predicted Phenotype Type Position Mutation %Identity %Overlap HSP Length/Total Length Contig Start End Pointfinder Position CGE Notes CGE Required Mutation CGE Mechanism CGE PMID
pbp5 pbp5 (A216S), pbp5 (A499T), pbp5 (A68T), pbp5 (D204G), pbp5 (E100Q), pbp5 (E525D), pbp5 (E629V), pbp5 (E85D), pbp5 (G66E), pbp5 (K144Q), pbp5 (L177I), pbp5 (M485A), pbp5 (N496K), pbp5 (P667S), pbp5 (R34Q), pbp5 (S27G), pbp5 (T172A), pbp5 (T324A), pbp5 (V24A), pbp5 (V586L) ampicillin - complex 524, 527, 534, 566, 568, 585, 5100, 5144, 5172, 5177, 5204, 5216, 5324, 5485, 5496, 5499, 5525, 5586, 5629, 5667 complex 98.28 100.00 2037/2037 pbp5_1_AAK43724.1 1 2037 pbp5 (A216S), pbp5 (A499T), pbp5 (A68T), pbp5 (D204G), pbp5 (E100Q), pbp5 (E525D), pbp5 (E629V), pbp5 (E85D), pbp5 (G66E), pbp5 (K144Q), pbp5 (L177I), pbp5 (M485A), pbp5 (N496K), pbp5 (P667S), pbp5 (R34Q), pbp5 (S27G), pbp5 (T172A), pbp5 (T324A), pbp5 (V24A), pbp5 (V586L) - - - -

The complex mutation TSV file may be specifed on the command line when running Pointfinder:

staramr search --pointfinder-organism enterococcus_faecium -o out pbp5.fa --complex-mutations-file complex_mutations.tsv

Output

There are 8 different output files produced by staramr:

  1. summary.tsv: A summary of all detected AMR genes/mutations/plasmids/sequence type in each genome, one genome per line. A series of descriptive statistics is also provided for each genome as well as feedback for whether or not the genome passes several quality metrics and if not, feedback on why the genome fails.
  2. detailed_summary.tsv: A detailed summary of all detected AMR genes/mutations/plasmids/sequence type in each genome, one gene per line.
  3. resfinder.tsv: A tabular file of each AMR gene and additional BLAST information from the ResFinder database, one gene per line.
  4. pointfinder.tsv: A tabular file of each AMR point mutation and additional BLAST information from the PointFinder database, one gene per line.
  5. plasmidfinder.tsv: A tabular file of each AMR plasmid type and additional BLAST information from the PlasmidFinder database, one plasmid type per line.
  6. mlst.tsv: A tabular file of each multi-locus sequence type (MLST) and it's corresponding locus/alleles, one genome per line.
  7. settings.txt: The command-line, database versions, and other settings used to run staramr.
  8. results.xlsx: An Excel spreadsheet containing the previous 6 files as separate worksheets.

In addition, the directory hits/ stores fasta files of the specific blast hits.

summary.tsv

The summary.tsv output file generated by staramr contains the following columns:

  • Isolate ID: The id of the isolate/genome file(s) passed to staramr.
  • Quality Module: The isolate/genome file(s) pass/fail result(s) for the quality metrics
  • Genotype: The AMR genotype of the isolate.
  • Predicted Phenotype: The predicted AMR phenotype (drug resistances) for the isolate.
  • CGE Predicted Phenotype: The CGE-predicted AMR phenotype (drug resistances) for the isolate.
  • Plasmid: Plasmid types that were found for the isolate.
  • Scheme: The MLST scheme used
  • Sequence Type: The sequence type that's assigned when combining all allele types
  • Genome Length: The isolate/genome file(s) genome length(s)
  • N50 value: The isolate/genome file(s) N50 value(s)
  • Number of Contigs Greater Than Or Equal To 300 bp: The number of contigs greater or equal to 300 base pair in the isolate/genome file(s)
  • Quality Module Feedback: The isolate/genome file(s) detailed feedback for the quality metrics

Example

Isolate ID Quality Module Genotype Predicted Phenotype CGE Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
SRR1952908 Passed aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline Spectinomycin, Streptomycin, Amoxicillin, Ampicillin, Cephalothin, Piperacillin, Ticarcillin, Chloramphenicol, Nalidixic acid, Ciprofloxacin, Sulfamethoxazole, Doxycycline, Tetracycline ColpVC, IncFIB(S), IncFII(S), IncI1-I(Alpha) senterica_achtman_2 11 4785500 250423 41
SRR1952926 Passed blaTEM-57, gyrA (S83Y), tet(A) ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline Amoxicillin, Ampicillin, Cephalothin, Piperacillin, Ticarcillin, Nalidixic acid, Ciprofloxacin, Doxycycline, Tetracycline ColpVC, IncFIB(S), IncFII(S), IncI1-I(Alpha) senterica_achtman_2 11 4785451 228311 40

detailed_summary.tsv

The detailed_summary.tsv output file generated by staramr contains the following columns:

  • Isolate ID: The id of the isolate/genome file(s) passed to staramr.
  • Data: The particular gene detected from ResFinder, PlasmidFinder, PointFinder, or the sequence type.
  • Data Type: The type of gene (Resistance or Plasmid), or MLST.
  • Predicted Phenotype: The predicted AMR phenotype (drug resistances) found in ResFinder/PointFinder. Plasmids will be left blank by default.
  • CGE Predicted Phenotype: The CGE-predicted AMR phenotype (drug resistances) found in ResFinder/PointFinder. Plasmids will be left blank by default.
  • %Identity: The % identity of the top BLAST HSP to the gene.
  • %Overlap: THe % overlap of the top BLAST HSP to the gene (calculated as hsp length/total length * 100).
  • HSP Length/Total Length The top BLAST HSP length over the gene total length (nucleotides).
  • Contig: The contig id containing this gene.
  • Start: The start of the gene (will be greater than End if on minus strand).
  • End: The end of the gene.
  • Accession: The accession of the gene from either ResFinder or PlasmidFinder database.

Example

Isolate ID Data Data Type Predicted Phenotype CGE Predicted Phenotype %Identity %Overlap HSP Length/Total Length Contig Start End Accession
SRR1952908 ST11 (senterica_achtman_2) MLST
SRR1952908 ColpVC Plasmid 98.96 100.0 193/193 contig00038 1618 1426 JX133088
SRR1952908 aadA1 Resistance streptomycin Spectinomycin, Streptomycin 100.0 100.0 792/792 contig00030 5355 4564 JQ414041

resfinder.tsv

The resfinder.tsv output file generated by staramr contains the following columns:

  • Isolate ID: The id of the isolate/genome file(s) passed to staramr.
  • Gene: The particular AMR gene detected.
  • Predicted Phenotype: The predicted AMR phenotype (drug resistances) for this gene.
  • CGE Predicted Phenotype: The CGE-predicted AMR phenotype (drug resistances) for this gene.
  • %Identity: The % identity of the top BLAST HSP to the AMR gene.
  • %Overlap: THe % overlap of the top BLAST HSP to the AMR gene (calculated as hsp length/total length * 100).
  • HSP Length/Total Length The top BLAST HSP length over the AMR gene total length (nucleotides).
  • Contig: The contig id containing this AMR gene.
  • Start: The start of the AMR gene (will be greater than End if on minus strand).
  • End: The end of the AMR gene.
  • Accession: The accession of the AMR gene in the ResFinder database.
  • Sequence: The AMR Gene sequence
  • CGE Notes: Any CGE notes associated with the prediction.

Example

Isolate ID Gene Predicted Phenotype CGE Predicted Phenotype %Identity %Overlap HSP Length/Total Length Contig Start End Accession Sequence CGE Notes
SRR1952908 sul3 sulfisoxazole Sulfamethoxazole 100.00 100.00 792/792 contig00030 2091 2882 AJ459418 ATGA[...]
SRR1952908 tet(A) tetracycline Doxycycline, Tetracycline 99.92 97.80 1247/1275 contig00032 1476 2722 AF534183 ATGT[...]

pointfinder.tsv

The pointfinder.tsv output file generated by staramr contains the following columns:

  • Isolate ID: The id of the isolate/genome file(s) passed to staramr.
  • Gene: The particular AMR gene detected, with the point mutation within.
  • Predicted Phenotype: The predicted AMR phenotype (drug resistances) for this gene.
  • CGE Predicted Phenotype: The CGE-predicted AMR phenotype (drug resistances) for this gene.
  • Type: The type of this mutation from PointFinder (either codon or nucleotide).
  • Position: The position of the mutation. For codon type, the position is the codon number in the gene, for nucleotide type it is the nucleotide number.
  • Mutation: The particular mutation. For codon type lists the codon mutation, for nucleotide type lists the single nucleotide mutation.
  • %Identity: The % identity of the top BLAST HSP to the AMR gene.
  • %Overlap: The % overlap of the top BLAST HSP to the AMR gene (calculated as hsp length/total length * 100).
  • HSP Length/Total Length The top BLAST HSP length over the AMR gene total length (nucleotides).
  • Contig: The contig id containing this AMR gene.
  • Start: The start of the AMR gene (will be greater than End if on minus strand).
  • End: The end of the AMR gene.
  • Pointfinder Position: The Pointfinder-adjusted position, which may be off by one from the sequence position in the case of some indels.
  • CGE Notes: Any CGE notes associated with the prediction.
  • CGE Required Mutation: Any additional mutations that CGE predicts are required to confer the CGE predicted phenotype.
  • CGE Mechanism: The CGE-reported mechanism.
  • CGE PMID: The PMID ID associated with the CGE prediction.

Example

Isolate ID Gene Predicted Phenotype CGE Predicted Phenotype Type Position Mutation %Identity %Overlap HSP Length/Total Length Contig Start End Pointfinder Position CGE Notes CGE Required Mutation CGE Mechanism CGE PMID
SRR1952908 gyrA (S83Y) ciprofloxacin I/R, nalidixic acid Nalidixic acid,Ciprofloxacin codon 83 TCC -> TAC (S -> Y) 99.96 100.00 2637/2637 contig00008 22801 20165 S83Y Target modification 7492118,10471553
SRR1952926 gyrA (S83Y) ciprofloxacin I/R, nalidixic acid Nalidixic acid,Ciprofloxacin codon 83 TCC -> TAC (S -> Y) 99.96 100.00 2637/2637 contig00011 157768 160404 S83Y Target modification 7492118,10471553

plasmidfinder.tsv

The plasmidfinder.tsv output file generated by staramr contains the following columns:

  • Isolate ID: The id of the isolate/genome file(s) passed to staramr.
  • Plasmid: The particular plasmid type detected.
  • %Identity: The % identity of the top BLAST HSP to the plasmid type.
  • %Overlap: The % overlap of the top BLAST HSP to the plasmid type (calculated as hsp length/total length * 100).
  • HSP Length/Total Length The top BLAST HSP length over the plasmid type total length (nucleotides).
  • Contig: The contig id containing this plasmid type.
  • Start: The start of the plasmid type (will be greater than End if on minus strand).
  • End: The end of the plasmid type.
  • Accession: The accession of the plasmid type in the PlasmidFinder database.

Example

Isolate ID Plasmid %Identity %Overlap HSP Length/Total Length Contig Start End Accession
SRR1952908 ColpVC 98.96 100 193/193 contig00038 1618 1426 JX133088
SRR1952908 IncFIB(S) 98.91 100 643/643 contig00024 10302 9660 FN432031

mlst.tsv

The mlst.tsv output file generated by staramr contains the following columns:

  • Isolate ID: The id of the isolate/genome file(s) passed to staramr.
  • Scheme: The scheme that MLST has identified.
  • Sequence Type: The sequence type that's assigned when combining all allele types
  • Locus #: A particular locus in the specified MLST scheme.

Example

Isolate ID Scheme Sequence Type Locus 1 Locus 2 Locus 3 Locus 4 Locus 5 Locus 6 Locus 7
SRR1952908 senterica_achtman_2 11 aroC(5) dnaN(2) hemD(3) hisD(7) purE(6) sucA(6) thrA(11)
SRR1952926 senterica_achtman_2 11 aroC(5) dnaN(2) hemD(3) hisD(7) purE(6) sucA(6) thrA(11)

settings.txt

The settings.txt file contains the particular settings used to run staramr.

  • command_line: The command line used to run staramr.
  • version: The version of staramr.
  • start_time,end_time,total_minutes: The start, end, and duration for running staramr.
  • resfinder_db_dir, pointfinder_db_dir, plasmidfinder_db_dir : The directory containing the ResFinder, PointFinder, and PlasmidFinder databases.
  • resfinder_db_url, pointfinder_db_url, plasmidfinder_db_url: The URL to the git repository for the ResFinder, PointFinder, and PlasmidFinder databases.
  • resfinder_db_commit, pointfinder_db_commit, plasmidfinder_db_commit: The git commit ids for the ResFinder, PointFinder, and PlasmidFinder databases.
  • resfinder_db_date, pointfinder_db_date, plasmidfinder_db_date: The date of the git commits of the ResFinder, PointFinder, and PlasmidFinder databases.
  • mlst_version: The version of MLST.
  • pointfinder_gene_drug_version, resfinder_gene_drug_version: A version identifier for the gene/drug mapping table used by staramr.

Example

Settings Output Example

hits/

The hits/ directory contains the BLAST HSP nucleotides for the entries listed in the resfinder.tsv and pointfinder.tsv files. There are up to two files per input genome, one for ResFinder and one for PointFinder.

For example, with an input genome named SRR1952908.fasta there would be two files hits/resfinder_SRR1952908.fasta and hits/pointfinder_SRR1952908.fasta. These files contain mostly the same information as in the resfinder.tsv, pointfinder.tsv, and plasmidfinder.tsv files. Additional information is the database_gene_start and database_gene_end listing the start/end of the BLAST HSP on the AMR resistance gene from the ResFinder/PointFinder/PlasmidFinder databases.

Example

>aadA1_3_JQ414041 isolate: SRR1952908, contig: contig00030, contig_start: 5355, contig_end: 4564, database_gene_start: 1, database_gene_end: 792, hsp/length: 792/792, pid: 100.00%, plength: 100.00%
ATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATC
GAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGC
...

Tutorial

A tutorial guiding you though the usage of staramr, interpreting the results, and comparing with antimicrobial resistances available on NCBI can be found at staramr tutorial.

Usage

Main Command

Main staramr command. Can be used to set global options (primarily --verbose).

Main Command

Search

Searches input FASTA files for AMR genes.

Search Command

Database Build

Downloads and builds the ResFinder, PointFinder, and PlasmidFinder databases.

Database Build Command

Database Update

Updates an existing download of the ResFinder, PointFinder, and PlasmidFinder databases.

Database Update Command

Database Info

Prints information about an existing build of the ResFinder/PointFinder/PlasmidFinder databases.

Database Info Command

Database Restore Default

Restores the default database for staramr.

Database Restore Default Command

Caveats

This software is still a work-in-progress. In particular, not all organisms stored in the PointFinder database are supported (only salmonella, campylobacter are currently supported). Additionally, the predicted phenotypes are for microbiological resistance and not clinical resistance. Phenotype/drug resistance predictions are an experimental feature which is continually being improved.

staramr only works on assembled genomes and not directly on reads. A quick genome assembler you could use is Shovill. Or, you may also wish to try out the ResFinder webservice, or the command-line tools rgi or ariba which will work on sequence reads as well as genome assemblies. You may also wish to check out the CARD webservice.

Acknowledgements

Some ideas for the software were derived from the ResFinder, PointFinder, and PlasmidFinder command-line software, as well as from ABRicate and from SISTR (Salmonella In Silico Typing Resource) command-line tool .

Phenotype/drug resistance predictions are provided with support from the NARMS/CIPARS Molecular Working Group.

The Multi-locus sequence typing program is from the MLST Github.

Citations

If you find staramr useful, please cite the following paper:

Bharat A, Petkau A, Avery BP, Chen JC, Folster JP, Carson CA, Kearney A, Nadon C, Mabon P, Thiessen J, Alexander DC, Allen V, El Bailey S, Bekal S, German GJ, Haldane D, Hoang L, Chui L, Minion J, Zahariadis G, Domselaar GV, Reid-Smith RJ, Mulvey MR. Correlation between Phenotypic and In Silico Detection of Antimicrobial Resistance in Salmonella enterica in Canada Using Staramr. Microorganisms. 2022; 10(2):292. https://doi.org/10.3390/microorganisms10020292

You may also consider citing the following (databases or other resources used by staramr):

Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, Lund O, Aarestrup FM, Larsen MV. 2012. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 67:2640–2644. doi: 10.1093/jac/dks261

Zankari E, Allesøe R, Joensen KG, Cavaco LM, Lund O, Aarestrup F. PointFinder: a novel web tool for WGS-based detection of antimicrobial resistance associated with chromosomal point mutations in bacterial pathogens. J Antimicrob Chemother. 2017; 72(10): 2764–8. doi: 10.1093/jac/dkx217

Carattoli A, Zankari E, Garcia-Fernandez A, Voldby Larsen M, Lund O, Villa L, Aarestrup FM, Hasman H. PlasmidFinder and pMLST: in silico detection and typing of plasmids. Antimicrob. Agents Chemother. 2014. April 28th. doi: 10.1128/AAC.02412-14

Seemann T, MLST Github https://github.com/tseemann/mlst

Jolley KA, Bray JE and Maiden MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications [version 1; peer review: 2 approved]. Wellcome Open Res 2018, 3:124. doi: 10.12688/wellcomeopenres.14826.1

Legal

Copyright 2018 Government of Canada

Licensed under the Apache License, Version 2.0 (the "License"); you may not use this work except in compliance with the License. You may obtain a copy of the License at:

http://www.apache.org/licenses/LICENSE-2.0

Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.