motif-scraper

Tool for finding degenerate motifs in FASTA files


Keywords
degenerate, sequence, motif, site, search
License
MIT
Install
pip install motif-scraper==1.0.0

Documentation

Build Status

Motif Scraper

Pythonic tool to search for degenerate motif matches in FASTA sequence files.

Installation

Motif scraper is available via pip or GitHub download. We HIGHLY recommend installing in a Python virtual environment.

pip install motif_scraper

Or user install

pip install --user motif_scraper

Or install from GitHub clone.

git clone https://github.com/RobersonLab/motif_scraper.git
git checkout vN.N.N # Choose highest version tag instead of vN.N.N

pip install -e .

Testing local install

The installation can be quickly checked for proper installation in a Linux-like environment that has wget. If necessary, first switch to the appropriate virtual environment. The following code snippet will download a test FASTA file containing only human contig KI270394.1 from the GRCh38 human genome build and search a simple exact motif.

wget https://raw.githubusercontent.com/RobersonLab/motif_scraper/master/sample_data/KI270394.fa
motif_scraper --motif TTTGCA --outputFile test.csv KI270394.fa

The logging for the tool should list that 3 sites were found. You can confirm them with:

cat test.csv

which should display the following:

Contig,Start,End,Strand,Sequence,Motif
KI270394.1,94,99,+,TTTGCA,TTTGCA
KI270394.1,436,441,+,TTTGCA,TTTGCA
KI270394.1,170,165,-,TTTGCA,TTTGCA

Usage

Find all sites for the CTCF motif NNDCCACYAGRKGGCASYR in GRCh38.

motif_scraper --motif NNDCCACYAGRKGGCASYR --outputFile ctcf_sites.csv --search_strand=both GRCh38.fa

Find CTCF sites on chromosome 1 only.

motif_scraper -r chr1 --motif NNDCCACYAGRKGGCASYR --outputFile ctcf_sites.csv --search_strand=both GRCh38.fa

Find CTCF sites only from position 10,000 to position 10,000,000 on chromosome 1.

motif_scraper -r chr1:10000-10000000 --motif NNDCCACYAGRKGGCASYR --outputFile ctcf_sites.csv --search_strand=both GRCh38.fa

Find CTCF match sites only on the top strand, using 10 processors.

motif_scraper --cores 10 --motif NNDCCACYAGRKGGCASYR --outputFile ctcf_sites.csv --search_strand=+1 GRCh38.fa

Search an Ensembl download of all protein coding transcript 3' UTRs for hsa-miR-10a sites on minus strand.

motif_scraper --cores 10 --motif TACCCTGTAGATCCGAATTTGTG --outputFile mir10a_sites.csv --search_strand=-1 GRCh38_3pUTRs.fa

Search an Ensembl download of all protein coding transcript 3' UTRs for hsa-miR-10a sites on minus strand, again. But this time print output to temporary file per contig / strand. Combines and removes the temporary files last. Produces identical md5 sum to memory buffering all sites first, but works on low memory machines.

motif_scraper --file_buffer --cores 10 --motif TACCCTGTAGATCCGAATTTGTG --outputFile mir10a_sites.csv --search_strand=-1 GRCh38_3pUTRs.fa

Get debugging messages to troubleshoot code problems.

motif_scraper --loglevel DEBUG --cores 10 --motif TACCCTGTAGATCCGAATTTGTG --outputFile mir10a_sites.csv --search_strand=-1 GRCh38_3pUTRs.fa

Search for all motifs contained in a file.

motif_scraper --motif_file many_motifs.txt --outputFile many_motif_sites.csv GRCh38.fa

Directly input a valid regular expression instead of a sequence motif

motif_scraper --motif N{19}CTR{3} --valid_regex GRCh38.fa